Annals of Tropical Medicine and Public Health
Home About us Ahead Of Print Instructions Submission Subscribe Advertise Contact e-Alerts Editorial Board Login 
Users Online:2204
  Print this page  Email this page Small font sizeDefault font sizeIncrease font size
 


 
Table of Contents   
ORIGINAL ARTICLE  
Year : 2014  |  Volume : 7  |  Issue : 1  |  Page : 19-24
Screening for methicillin-resistant Staphylococcus aureus carriers among individuals exposed and not exposed to the hospital environment and their antimicrobial sensitivity pattern


Department of Medical Microbiology, Sri Siddharta Medical College, Tumkur, Karnataka, India

Click here for correspondence address and email

Date of Web Publication20-Nov-2014
 

   Abstract 

Aims: This study evaluated the influence of exposure to the hospital environment on methicillin-resistant Staphylococcus aureus (MRSA) carriage. The antibiograms of the MRSA isolates were examined. Materials and Methods: Nasal, throat, and web-space swabs were collected from 119 nursing students of the age group 18-23 years (exposed group) and 100 age-matched pharmacy students (nonexposed group). S. aureus was identified and antibiogram obtained as per Clinical and Laboratory Standards Institute (CLSI) guidelines. MRSA was detected by cefoxitin disc diffusion test and by growth on oxacillin screen agar as per CLSI guidelines. The presence of the mecA gene was confirmed by conventional polymerase chain reaction. Results: The MRSA carrier rates were 11.8% and 4% in the exposed and nonexposed groups, respectively. Association of exposure to the hospital environment with MRSA colonization was statistically significant. All MRSA isolates showed sensitivity to netilmicin, linezolid, tetracycline, vancomycin and teicoplanin. Among the exposed group, 71.4% MRSA isolates were resistant to ciprofloxacin, 64.3% to cotrimoxazole, 64.3% to erythromycin, 28.6% to gentamicin and 21.4% to clindamycin. Among the nonexposed group, 75% MRSA isolates were resistant to ciprofloxacin, 25% to cotrimoxazole, 25% to erythromycin, 25% to gentamicin and 25% to clindamycin. Conclusion: Exposure to the hospital environment was found to be a significant risk factor for MRSA carriage. Hospital-acquired MRSA (HA-MRSA) isolates showed greater resistance toward antimicrobials compared with community-acquired MRSA (CA-MRSA) isolates. This highlights the need for the appropriate institution of pharmacotherapy in cases of HA-MRSA and CA-MRSA infections and control of transmission by carriers.

Keywords: Antibiotic resistance, hospital infection, infectious disease transmission, methicillin-resistant Staphylococcus aureus

How to cite this article:
Renushri BV, Saha A, Nagaraj ER, Rama N K, Krishnamurthy V, Chandrashekar S C. Screening for methicillin-resistant Staphylococcus aureus carriers among individuals exposed and not exposed to the hospital environment and their antimicrobial sensitivity pattern. Ann Trop Med Public Health 2014;7:19-24

How to cite this URL:
Renushri BV, Saha A, Nagaraj ER, Rama N K, Krishnamurthy V, Chandrashekar S C. Screening for methicillin-resistant Staphylococcus aureus carriers among individuals exposed and not exposed to the hospital environment and their antimicrobial sensitivity pattern. Ann Trop Med Public Health [serial online] 2014 [cited 2019 Nov 12];7:19-24. Available from: http://www.atmph.org/text.asp?2014/7/1/19/145003

   Introduction Top


Staphylococcus aureus is a Gram-positive coccus, causing both localised and systemic infections. In the preantibiotic era, mortality due to S. aureus was estimated to be 90%. [1] With the introduction of β-lactam antibiotics such as penicillin, treatment of S. aureus infections was made easier. However, most strains are now not only resistant to β-lactams, but also to newer β-lactamase resistant semisynthetic penicillins like methicillin. These strains are called methicillin-resistant S. aureus (MRSA). [2],[3] MRSA strains resistant to other commonly used antibiotics such as aminoglycosides and lincosamides have also emerged. [2],[4]

Strains of MRSA are known to colonize single or multiple body sites, and this colonization may be either transient or persistent. [2],[3] The anterior nares, throat, axillae, palms, web spaces, rectum and perineum are important reservoirs of MRSA. [2],[3],[5],[6],[7]]

Carriers of MRSA are not only at increased risk for developing subsequent infections with the strains they carry, but also transmit the pathogen between individuals. [2],[3] Breaches of host integrity caused by wounds, aspiration, catheterization, and surgery can lead to infection by colonizing strains. [8]

Methicillin-resistant Staphylococcus aureus is a major problem within healthcare organizations. It is an important nosocomial pathogen worldwide, accounting for 20-80% of nosocomial infections in different healthcare set-ups. [1] MRSA acquired in a healthcare institution is called hospital-acquired MRSA (HA-MRSA). The established risk factors for HA-MRSA infections are recent hospitalisation, surgery, dialysis, long-term indwelling catheters, implantation of percutaneous medical device and history of MRSA infection in the past. [1]

However, the epidemiology of MRSA is changing with infections appearing in healthy community-dwelling individuals without any apparent risk factors for the acquisition of MRSA. [9] Strains causing such infections are called community-acquired MRSA (CA-MRSA). [1],[8]

Although, there are significant differences in the clinical features, antimicrobial resistance patterns and treatment requirements of HA-MRSA and CA-MRSA, both have been linked to greater morbidity and mortality, as well as to increased hospital stays and treatment costs. [1],[8]

At present, sustained research that evaluates the impact of exposure to hospital environment vis-à-vis that of exposure in the community on MRSA carriage is lacking in India. The present case-control study evaluates the influence of exposure to the hospital environment on MRSA carrier rates by comparing the prevalence of HA-MRSA and CA-MRSA carriage.

The antimicrobial sensitivity patterns of MRSA isolates from carriers are also examined. This could enable appropriate institution of pharmacotherapy in cases of HA-MRSA and CA-MRSA infections, besides leveraging control of transmission by carriers.


   Materials and Methods Top


Inclusion and exclusion criteria

One hundred and nineteen students of the age group 18-23 years of the college of nursing attached to our hospital were included in the study. All students attended rotating sessions for at least 4 h daily in various hospital departments for the last 6 months. They represented the group exposed to the hospital environment. However, exposure of these students to specific wards or patients was not considered as they were posted to multiple wards in a day. Moreover, several patients were discharged, referred or otherwise lost to follow-up for the purposes of this study.

One hundred age-matched students of the college of pharmacy in our city were also studied. None of the students in this group had a history of hospitalization or regular visits to a hospital in the last 6 months. They represented the group not exposed to the hospital environment.

None of the subjects had a history of illness or treatment with an antibiotic in the last 6 months. Informed written consent was obtained from all subjects.

Collection of samples

Nasal swabs

Specimens from both anterior nares were obtained from each subject by carefully inserting sterile cotton swabs moistened with sterile saline into each nostril so that the tip was entirely at the nasal osteum level (about 2.5 cm from the edge of the nare) and gently rolling 2-3 times.

Throat swabs

Specimens were obtained by carefully inserting sterile cotton swabs into the oral cavity (after depressing the tongue) and gently rolling it over the fauces and posterior wall of oropharynx.

Palmar swabs and swabs from web-spaces

Specimens were obtained by gently rolling sterile cotton swabs moistened with sterile saline over the palm and web spaces.

All swabs were immediately processed for culture and isolation.

Culture

Swabs were immediately inoculated on 10% mannitol salt agar (HiMedia, Mumbai) and 5% sheep blood agar and incubated at 35°C in ambient air. [10],[11]

The blood agar plates were examined for growth after 24 h of incubation and the mannitol salt agar plates after 48 h of incubation. [11]

Identification

Identification of Staphylococcus aureus

β-hemolytic and yellow colored mannitol fermenting colonies were picked up and sub-cultured on nutrient agar plates for further processing.

Staphylococcus aureus was identified by golden-yellow pigment production, Gram's-stain, catalase test and slide and tube coagulase tests. [10],[12]

Identification of methicillin-resistant Staphylococcus aureus

Cefoxitin disc diffusion test

Each of the S. aureus isolates was subjected to cefoxitin disc diffusion test using a 30 μg cefoxitin disc (HiMedia, Mumbai). A 0.5 McFarland standard suspension of the isolate was made and lawn culture done on Mueller-Hinton agar plate (HiMedia, Mumbai). Plates were incubated at 37°C for 18 h, and zone diameters were measured. An inhibition zone diameter of ≤21 mm was reported as oxacillin or methicillin-resistant and a zone diameter of ≥22 mm was considered sensitive, as per Clinical Laboratory Standards Institute (CLSI) guidelines. [13],[14]

Using oxacillin screen agar

A suspension equivalent to McFarland 0.5 was prepared from each S. aureus isolate. A swab was dipped in this suspension and spotted over an area 10 mm in diameter on the surface of a Mueller-Hinton agar plate supplemented with 4% NaCl and 6 μg/ml of oxacillin (HiMedia, Mumbai). Plates were incubated at 35°C for 24 h and then observed carefully in transmitted light for growth. Any growth after 24 h was considered oxacillin resistant. [13]

Quality control strains - MRSA ATCC 43300 and methicillin-sensitive S. aureus ATCC 25923 were used as positive and negative controls respectively. [15]

Detection of mecA gene

Resistance to methicillin was verified by detection of the mecA gene by conventional polymerase chain reaction. [16] The primer pair was designed using primer BLAST and Gene Runner software version 3.05 (Hastings Software Inc., USA). The quality control strain used was ATCC 700699. The annealing temperature was 58°C. The amplicon size was 806 base pairs. The forward primer was 5'TCCAGGAATGCAGAAAGAC3' and the reverse primer was 5'CTGGTGAAGTTGTAATCTGGA3'. In the case of multiple isolates acquired from the same participant, the first detected isolate of MRSA was included in the study.

Sensitivity to other antibiotics

Standard disc diffusion test was employed for other antibiotics as per CLSI guidelines. [14] Antibiotic discs of penicillin, cotrimoxazole, ciprofloxacin, gentamicin, netilmicin, tetracycline, erythromycin, clindamycin, linezolid, vancomycin and teicoplanin (HiMedia, Mumbai) were used.

Data analysis

The S. aureus and MRSA carrier rates of each group were calculated.

Statistical analysis of the association of the risk factor (exposure to the hospital environment) with MRSA colonization was carried out using the Chi-square test. Odds ratio was also calculated.

Resistance among MRSA to other antibiotics was examined.


   Results Top


A total of 14 students were found to be carriers of MRSA in the group exposed to hospital environment and four students were found to be carriers in the group not exposed to a hospital environment [Table 1].
Table 1: Number of MRSA and MSSA carriers from group exposed and group not exposed to hospital environment

Click here to view


The MRSA carrier rate was found to be 11.8% [Figure 1] in the group exposed to the hospital environment and 4% [Figure 2] in the group not exposed to the hospital environment.
Figure 1: Proportion of methicillin-resistant Staphylococcus aureus carriers, methicillin-sensitive S. aureus carriers and noncarriers in exposed group

Click here to view
Figure 2: Proportion of methicillin-resistant Staphylococcus aureus carriers, methicillin-sensitive S. aureus carriers and noncarriers in non-exposed group

Click here to view


Association of exposure to the hospital environment with MRSA colonization was found to be statistically significant (χ2 = 4.34; P = 0.0372). The exposure rate among those exposed to a hospital environment was 77.8% and among those not exposed was 52.2%. The odds ratio was found to be 3.2.

The number of individuals in both groups in whom MRSA isolates were found in multiple sites is shown in [Table 2].
Table 2: Number of individuals that carried MRSA in one of the sites, two of the sites and all three sites examined in the exposed and nonexposed groups

Click here to view


The antibiotic resistance patterns of MRSA isolated from the exposed and nonexposed groups are given in [Table 3] and depicted graphically in [Figure 3] and [Figure 4].
Figure 3: Antibiotic resistance pattern of methicillin-resistant Staphylococcus aureus isolated from group exposed to hospital environment. *Isolates with intermediate resistance were included with the resistant ones. †All
clindamycin resistant isolates showed positive D-test


Click here to view
Figure 4: Antibiotic resistance pattern of methicillin-resistant Staphylococcus aureus isolated from group not exposed to hospital environment. *Isolates with intermediate resistance were included with the resistant ones. †All clindamycin resistant isolates showed positive D-test

Click here to view
Table 3: Antibiotic resistance patterns of MRSA isolated from the exposed and non-exposed groups

Click here to view



   Discussion Top


In the present study, the carrier rate of MRSA among the group exposed to the hospital environment was 11.8%. This result is comparable to that obtained in other studies done in India, where MRSA carrier rates among inpatients, surgical unit staff and healthcare workers were found to be 15.6%, 15.4% and 6.6%, respectively. [7],[17],[18] However, this result was higher than the carrier rates of 3.5% and 4.7% in studies in Jordan and Saudi Arabia respectively. [19],[20] This could be due to the more extensive use of β-lactam antibiotics in India and the consequent selection pressure.

The carrier rate of the group not exposed to the hospital environment was 4%. This result was lower than those obtained in other Indian studies, which showed carrier rates of MRSA among healthy community-dwelling individuals ranging from 11.1% to 18.1%. [21],[22] This could be because our study included only individuals in the age group of 18-23 years, whereas the other studies did not have any such inclusion criterion.

Our results were closer to those obtained in studies in Jordan and Saudi Arabia that showed MRSA carriage rates in the community to be 1.7% and 1.3% respectively. [19],[20] The low carrier rates in Jordan and Saudi Arabia could, however, be attributed to the more cautious use of β-lactam antibiotics in those countries.

The association between exposure to the hospital environment and MRSA carriage was found to be statistically significant (P = 0.0372). It was found that the odds of a person exposed to a hospital environment being colonized by MRSA was 3.2 times that of a person not exposed to a hospital environment. This can be attributed to the widespread use of antibiotics, particularly β-lactams, in a hospital setting and the resulting selection pressure that leads to the proliferation and transmission of MRSA strains.

The carriage sites of MRSA in the two study groups were also evaluated and the results are represented in [Figure 5].
Figure 5: Number of methicillin-resistant Staphylococcus aureus isolates from different sites of carriage in groups exposed and not exposed to hospital environment. N = Nose, T = Throat, W = Web space and palm, N + W = Nose and web space, N + T = Nose and throat, T + W = Throat and web space, N + T + W = Nose, throat and web space

Click here to view


The commonest site of MRSA colonization was found to be in the anterior nares in both groups, which is similar to many reports. [2],[3],[5],[6],[7]]

Furthermore, it may be noted that three of the 14 (21.4%) isolates were obtained from both the nose and web spaces in the group exposed to the hospital environment. This represents the commonest route of transmission of the organism to other individuals. [5]

The antibiotic sensitivity patterns of various MRSA isolates from among the two study groups were determined. All isolates in both the groups showed sensitivity to netilmicin, linezolid, vancomycin and teicoplanin. This is in agreement with other Indian studies. [6],[21],[22],[23] All isolates also showed sensitivity to tetracycline. This, however, is in contrast to other Indian studies that showed high levels of resistance exhibited by MRSA strains towards tetracycline. [21],[22] This could be attributed to the infrequent usage of tetracycline in our region.

Among the group exposed to the hospital environment, most MRSA isolates demonstrated resistance toward cotrimoxazole, ciprofloxacin and erythromycin. This is in agreement with other Indian studies [6],[22],[23],[24] and could be attributed to the frequent usage of these antimicrobials in a hospital setting.

Among the group not exposed to the hospital environment, most MRSA isolates demonstrated resistance towards ciprofloxacin.

The emergence of ciprofloxacin-resistant MRSA has been linked to the widespread use of ciprofloxacin for eradication of colonization and for the treatment of infections. [3]

In our study, few MRSA isolates in the two groups showed resistance towards gentamicin. However, other Indian studies reported high levels of resistance towards gentamicin among nosocomial MRSA strains. [6],[22]


   Conclusion Top


Exposure to the hospital environment was found to be a significant risk factor for MRSA carriage. The anterior nares were found to be the commonest site of MRSA carriage.

All MRSA isolates were sensitive to tetracycline, vancomycin, teicoplanin, linezolid and netilmicin. Most MRSA isolates showed resistance to ciprofloxacin. The resistant patterns of these strains to second-generation fluoroquinolones need to be evaluated further.

The epidemiological, microbiological and molecular differences between CA-MRSA and HA-MRSA necessitate different strategies to prevent, control and treat these two types of infections.

Screening of all healthcare workers and inpatients for MRSA carriage is not a feasible option. Only those at high risk of carrying MRSA need to be screened. Barrier nursing should be exercised when dealing with patients colonized or infected with MRSA. A few simple measures like hand washing, use of face-masks and avoidance of nose picking can reduce transmission of MRSA in healthcare setups.

Prevention of CA-MRSA carriage and control of transmission can be achieved by maintaining hand hygiene, avoiding sharing of personal items and cleaning environmental surfaces regularly.


   Acknowledgments Top


The study was funded in part by a studentship awarded by the Indian Council of Medical Research.

 
   References Top

1.
Basak S, Mallick SK, Bose S. Community associated methicillin-resistant Staphylococcus aureus (CA-MRSA) - An emerging pathogen: Are we aware? J Clin Diagn Res 2010;4:2111-5.  Back to cited text no. 1
    
2.
Lowy FD. Staphylococcus aureus infections. N Engl J Med 1998;339:520-32.  Back to cited text no. 2
    
3.
Mulligan ME, Murray-Leisure KA, Ribner BS, Standiford HC, John JF, Korvick JA, et al. Methicillin-resistant Staphylococcus aureus: A consensus review of the microbiology, pathogenesis, and epidemiology with implications for prevention and management. Am J Med 1993;94:313-28.  Back to cited text no. 3
    
4.
Deotale V, Mendiratta DK, Raut U, Narang P. Inducible clindamycin resistance in Staphylococcus aureus isolated from clinical samples. Indian J Med Microbiol 2010;28:124-6.  Back to cited text no. 4
[PUBMED]  Medknow Journal  
5.
Kluytmans J, van Belkum A, Verbrugh H. Nasal carriage of Staphylococcus aureus: Epidemiology, underlying mechanisms, and associated risks. Clin Microbiol Rev 1997;10:505-20.  Back to cited text no. 5
    
6.
Rajaduraipandi K, Mani KR, Panneerselvam K, Mani M, Bhaskar M, Manikandan P. Prevalence and antimicrobial susceptibility pattern of methicillin resistant Staphylococcus aureus: A multicentre study. Indian J Med Microbiol 2006;24:34-8.  Back to cited text no. 6
[PUBMED]  Medknow Journal  
7.
Mathanraj S, Sujatha S, Sivasangeetha K, Parija SC. Screening for methicillin-resistant Staphylococcus aureus carriers among patients and health care workers of a tertiary care hospital in south India. Indian J Med Microbiol 2009;27:62-4.  Back to cited text no. 7
[PUBMED]  Medknow Journal  
8.
Seymour P, Golding J. Hospital-acquired and community-acquired MRSA: Two distinct infections. Emerg Med 2009;41:36.  Back to cited text no. 8
    
9.
Kluytmans-Vandenbergh MF, Kluytmans JA. Community-acquired methicillin-resistant Staphylococcus aureus: Current perspectives. Clin Microbiol Infect 2006;12 Suppl 1:9-15.  Back to cited text no. 9
    
10.
Winn WC Jr, Koneman EW, Allen SD, Procop GW, Janda WM, Schreckenberger PC, et al., editors. Koneman′s Color Atlas and Textbook of Diagnostic Microbiology. 6 th ed. Baltimore (USA): Lippincott Williams & Wilkins; 2006.  Back to cited text no. 10
    
11.
Forbes BA, Sahm DF, Weissfeld AS, editors. Bailey & Scott′s Diagnostic Microbiology. 12 th ed. St. Louis (USA): Mosby Elsevier; 2007.  Back to cited text no. 11
    
12.
Baird D. Staphylococcus: Cluster-forming Gram-positive cocci. In: Collee JG, Marmion BP, Fraser AG, Simmons A, editors. Mackie & McCartney Practical Medical Microbiology. 14 th ed. New Delhi: Elsevier; 2006. p. 255.  Back to cited text no. 12
    
13.
Swenson JM, Patel JB, Jorgensen JH. Special phenotypic methods for detecting antibacterial resistance. In: Murray PR, Baron EJ, Landry ML, Jorgensen JH, Pfaller MA, editors. Manual of Clinical Microbiology. 9 th ed. Washington, DC: ASM Press; 2007. p. 1175-6.  Back to cited text no. 13
    
14.
Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Susceptibility Testing; Seventeenth Informational Supplement. CLSI document M100-S17. Wayne PA: CLSI; 2007.  Back to cited text no. 14
    
15.
Swenson JM, Spargo J, Tenover FC, Ferraro MJ. Optimal inoculation methods and quality control for the NCCLS oxacillin agar screen test for detection of oxacillin resistance in Staphylococcus aureus. J Clin Microbiol 2001;39:3781-4.  Back to cited text no. 15
    
16.
Sambrook J, Russell DW. Molecular Cloning: A Laboratory Manual. 3 rd ed., Vol. 1. New York: Cold Spring Harbor Laboratory Press; 2001.  Back to cited text no. 16
    
17.
Vinodhkumaradithyaa A, Uma A, Shirivasan M, Ananthalakshmi I, Nallasivam P, Thirumalaikolundusubramanian P. Nasal carriage of methicillin-resistant Staphylococcus aureus among surgical unit staff. Jpn J Infect Dis 2009;62:228-9.  Back to cited text no. 17
    
18.
Goyal R, Das S, Mathur M. Colonisation of methicillin resistant Staphylococcus aureus among health care workers in a tertiary care hospital of Delhi. Indian J Med Sci 2002;56:321-4.  Back to cited text no. 18
[PUBMED]  Medknow Journal  
19.
El-Jalil HA, Jallad M, Thwaini AJ. Nasal carriage of methicillin resistant Staphylococcus aureus in individuals exposed and not exposed to hospital environments. Eur J Sci Res 2008;22:570-4.  Back to cited text no. 19
    
20.
Alghaithy AA, Bilal NE, Gedebou M, Weily AH. Nasal carriage and antibiotic resistance of Staphylococcus aureus isolates from hospital and non-hospital personnel in Abha, Saudi Arabia. Trans R Soc Trop Med Hyg 2000;94:504-7.  Back to cited text no. 20
    
21.
Majumdar D, Barua A, Paul B. Prevalence of nasal carriage of methicillin resistant Staphylococci in healthy population of Gangtok, East Sikkim. J Int Med Sci Acad 2008;21:191-3.  Back to cited text no. 21
    
22.
Krishna BV, Patil AB, Chandrasekhar MR. Community-acquired methicillin-resistant Staphylococcus aureus in a South Indian city. Southeast Asian J Trop Med Public Health 2004;35:371-4.  Back to cited text no. 22
    
23.
Sarma JB, Ahmed GU. Characterisation of methicillin resistant S. aureus strains and risk factors for acquisition in a teaching hospital in northeast India. Indian J Med Microbiol 2010;28:127-9.  Back to cited text no. 23
[PUBMED]  Medknow Journal  
24.
Verma S, Joshi S, Chitnis V, Hemwani N, Chitnis D. Growing problem of methicillin resistant staphylococci - Indian scenario. Indian J Med Sci 2000;54:535-40.  Back to cited text no. 24
[PUBMED]  Medknow Journal  

Top
Correspondence Address:
Avinandan Saha
331, Sobha Zircon, Jakkur Plantations, Bengaluru - 560 064, Karnataka
India
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/1755-6783.145003

Rights and Permissions


    Figures

  [Figure 1], [Figure 2], [Figure 3], [Figure 4], [Figure 5]
 
 
    Tables

  [Table 1], [Table 2], [Table 3]



 

Top
 
  Search
 
    Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
    Email Alert *
    Add to My List *


    Abstract
   Introduction
    Materials and Me...
   Results
   Discussion
   Conclusion
   Acknowledgments
    References
    Article Figures
    Article Tables

 Article Access Statistics
    Viewed1843    
    Printed56    
    Emailed0    
    PDF Downloaded15    
    Comments [Add]    

Recommend this journal