Annals of Tropical Medicine and Public Health
Home About us Ahead Of Print Instructions Submission Subscribe Advertise Contact e-Alerts Editorial Board Login 
Users Online:2623
  Print this page  Email this page Small font sizeDefault font sizeIncrease font size
 


 
Table of Contents   
ORIGINAL ARTICLE  
Year : 2013  |  Volume : 6  |  Issue : 6  |  Page : 653-657
LRSA suspect, taken to molecular court, PCR trialled, proven guilty


1 Department of Microbiology, Calcutta Medical College, Kolkata, West Bengal, India
2 Department of Microbiology, Calcutta National Medical College, Kolkata, West Bengal, India

Click here for correspondence address and email

Date of Web Publication6-Sep-2014
 

   Abstract 

Background: A 31-year-old patient was admitted in our Medical College and Hospital following a road traffic accident, and with a history of Linezolid treatment for 10 days. Materials and Methods: Culture from wound swab revealed multiple pathogens. Among them, Staphylococcus aureus turned out to be Methicillin resistant (MRSA), and also showed resistance to Linezolid disc diffusion. Then PCR of the resistant strain as well as a sensitive strain followed by DNA sequencing was done. Results: Sequencing of the domain V region of the 23S rRNA gene revealed the presence of a G2576U mutation in LRSA (LZD-resistant S. aureus) in two 23s rRNA copy, rrn1 and rrn5. Conclusions: The patient's wound was infected with an MRSA strain, which was LRSA as well. LRSA is a rare occurrence, and rarely reported from Indian subcontinent. A constant vigil is necessary to detect this resistance, if possible with tools of molecular epidemiology.

Keywords: Gene sequencing, LRSA, MRSA

How to cite this article:
Chakraborty B, Chakraborty B, Dopthap YP, Banerjee D. LRSA suspect, taken to molecular court, PCR trialled, proven guilty. Ann Trop Med Public Health 2013;6:653-7

How to cite this URL:
Chakraborty B, Chakraborty B, Dopthap YP, Banerjee D. LRSA suspect, taken to molecular court, PCR trialled, proven guilty. Ann Trop Med Public Health [serial online] 2013 [cited 2019 Dec 6];6:653-7. Available from: http://www.atmph.org/text.asp?2013/6/6/653/140243

   Introduction Top


Staphylococcus aureus , a well-known pathogen, is notorious for causing pyogenic infections, both in the community setup, as well as in hospital environment. It is also remarkable for developing multidrug resistance day by day-especially becoming methicillin-resistant Staphylococcus aureus, otherwise known as MRSA. Linezolid, an oxazolidinone, has shown potent activity against Gram-positive organisms like MRSA, methicillin-resistant coagulase-negative Staphylococci (MR-CoNS), vancomycin-resistant Enterococci (VRE), and multidrug-resistant Streptococcus pneumoniae, and has thus become the clinicians' favorite blue-eyed boy. [1] It uniquely inhibits protein synthesis by binding to the peptidyltransferase center (PTC) of the 50S ribosomal subunit. [2],[3]

Linezolid resistance in S. aureus is extremely uncommon, and the surveys have revealed that >99% isolates are susceptible. [4],[5] There are three main mechanisms for developing LZD resistance:

  1. Mutations the domain V region of one or more of the 5 copies of 23S rRNA gene.
  2. Acquisition of plasmid-mediated ribosomal methyltransferase cfr gene.
  3. Deletion/mutation in the ribosomal protein L3 of PTC.


Among these three mechanisms, LZD resistance has been largely attributed to the first one. [3]


   Materials and Methods Top


We, hereby, present a case where a 31-year-old male was admitted to our tertiary care Medical College and hospital on 2 nd November, 2012. He presented with non-healing ulcer following road traffic accident around 2 months before the date of admission. There was no history of diabetes mellitus or hypertension.

He was treated with linezolid from 01.10.2012 for about 10 days-as advised by a quack. No other drug history or prescription was available.

Culture report from wound swab revealed S. aureus, Klebsiella pneumoniae, and Pseudomonas aeruginosa as well. Susceptibility testing was performed by Kirby-Bauer disc diffusion method following CLSI guideline. [6] The S. aureus isolate was found to be sensitive to vancomycin, cotrimoxazole, amikacin and ofloxacin, and resistant to penicillin, erythromycin, cefoxitin (hence MRSA), and linezolid. Growth upto the edge of 30 mg linezolid disc was noted. Linezolid susceptibility was then repeated by Stokes method with S. aureus ATCC strain as control, and again the test strain showed resistance.

The isolate was preserved by stabbing it in a semisolid media. At the same time a linezolid sensitive isolate of S. aureus was also preserved.

DNA extraction was done from both isolates and PCR was done with Taq DNA polymerase [Figure 1].
Figure 1: PCR with Taq polymerase showing primer set for 5 copies of 23S rRNA gene

Click here to view


Then, following Agarose gel electrophoresis of the amplified product, DNA sequencing was done from lanes 2, 3, 4 and 6 of gel (lane 2 and 6 representing LNZ rrn1 and LNZ rrn5, respectively).

After sequencing we got the following three sequences of two different copy of 23s rDNA (LNZr1, LNZr5) and as control we used pcr product of LSSA (LZD-sensitive S. aureus) DNA with rDNA1 primer set.

>LNZr1

TGGACGCCCTCAGTCCTCAGAATGGTTGGAA TCATTCATAGAG TGTAAAGGCAT AAGGGAGCT TGACTGCGAGACCTACA

AGTCGAGCAGGGTCGAAAGACGGACTTAGTGA TCCGGTGGTTCCGCATGGAAGGGCCATCGCTC AACGGATAAAAGCTAC

CCCGGGGATAACAGGCTTATCTCCCCCAAGA GTTCACATCGACGGGGAGGTTTGGCACCTCG ATGTCGGCTCATCGCATC

CTGGGGCTGTAGTCGGTCCCAAGGGTTGGG CTGTTCGCCCATTAAAGCGGTACGCTAGCTG GGTTCAGAACGTCGTGAGA

CAGTTCGGTCCCTATCCGTCGTGGGCGTAGGA AATTTGAGAGGAGCTGTCCTTAGTACGAGAGG ACCGGGATGGACATAC

CTCTGGTGTACCAGTTGTCGTGCCAACGGCA TAGCTGGGTAGCTATGTATGGACGGGATAAGT GCTGAAAGCATCTAAGC

ATGAAGCCCCCCTCAAGATGAGATTTCCCAAC TTCGGTTATAAGATCCCTCAAAGATGATGAGGT TAATAGGTTCGAGGT

GGAAGCGTGGTGACACGTGGAGCTGACGAATA

CTAATCGATCGAAGACTTAATCAATTTATTTCA ATGTTTTGCGAAGCA

AAATCATTTACTTACTATCTAGTTTTGAATGTA TAATCATTCTCTTGTCTGGTGACAATGGCAAG GAGGTCACACCTGTT

CCCATGCCGAACACAGAAGTTAAGCTCCTTA GCGCCGATGGTAGTTGGATTTACGTTCCGCT AGAGTAGGACGTTGCCAG

CCAAAAAAATAGAGATGGGAA (821nt)

>LNZr5

CCTAAAAAAAAAAGAGGAGCTAAGTTCCTC AGAATGGTTGGAAATCATTCATAGAGTGTAAA GGCATAAGGGAGCTTGAC

TGCGAGACCTACAAGTCGAGCAGGGTCGA AAGACGGACTTAGTGATCCGGTGGTTCCGCAT GGAAGGGCCATCGCTCAAC

GGATAAAAGCTACCCCGGGGATAACAGGCTT ATCTCCCCCAAGAGTTCACATCGACGGGGAGG TTTGGCACCTCGATGTC

GGCTCATCGCATCCTGGGGCTGTAGTCGGT CCCAAGGGTTGGGCTGTTCGCCCATTAAAGC GGTACGCTAGCTGGGTTCA

GAACGTCGTGAGACAGTTCGGTCCCTATCCG TCGTGGGCGTAGGAAATTTGAGAGGAGCTGT CCTTAGTACGAGAGGACC

GGGATGGACATACCTCTGGTGTACCAGTTG TCGTGCCAACGGCATAGCTGGGTAGCTATGTAT GGACGGGATAAGTGCTG

AAAGCATCTAAGCATGAAGCCCCCCTCAAG ATGAGATTTCCCAACTTCGGTTATAAGATCCC TCAAAGATGATGAGGTTA

ATAGGTTCGAGGTGGAAGCGTGGTGACACG TGGAGCTGACGAATACTAATCGATCGAAGACT TAATCAATTTATTTCAAT

GTTTTGCGAAGCAAAATCATTTACTTACTATC TAGTTTTGAATGTATAATCATTCTCTTGTCTGG TGACAATGGCAAGGA

GGTCACACCTGTTCCCATGCCGAACACAGAA GTTAAGCTCCTTAGCGCCGATGGTAGTTGGAT TTACGTTCCGCTAGAGT

AGGACGTTG CCAGGCAAAT TAAATTATTCCACA GTAGTCTATTGTGGTTTAGGAAAGAAAA (861nt)

>LNZcontrl

CGAGAGCG CTAAGGGTTTCCCTCA GGAATGGT TGGAATCATTCATAGAGTGTAAAGGCATAAG GGAGCTTGACTGCGAGA

CCTACAAGTCGAGCAGGGTCGAAAGACGG ACTTAGTGATC CGGTGGTTCCGC ATGGAAGGG CCATCGCTCAACGGATAAA

AGCTACCCCGGGGATAACAGGCTTATCTCCCC CAAGAGTTCACATCGACGGGGAGGTTTGGC ACCTCGATGTCGGCTCAT

CGCATCCTGGGGCTGTAGTCGGTCCCAAGG GTTGGGCTGTTCGCCCATTAAAGCGGTAC GCGAGCTGGGTTCAGAACGTC

GTGAGACAGTTCGGTCCCTATCCGTCGT GGGCGTAGGAAATTTGAGAGGAGCTGTC CTTAGTACGAGAGGACCGGGATGG

ACATACCTCTGGTGTACCAGTTGTCGTGCC AACGGCATAGCTGGGTAGCTATGTGTGGACG GGATAAGTGCTGAAAGCAT

CTAAGCATGAAGCCCCCCTCAAGATGAGAT TTCCCAACTTCGGTTATAAGATCCCTCAAA GATGATGAGGTTAATAGGTT

CGAGGTGGAAGCATGGTGACATGTGGAG CTGACGAATACTAATCGATCGAAGACTTAAT CAAAATAAAT GTTTTGCGAAG

CAAAATCACTTTTACTTACTATCTAGTTTT GAATGTATAATTTACATTCATATGTCTGGTGA CTATAGC AAGGAGGTCAC

ACCTGTTCCCATGCCGAACACAGAAGTTAA GCTCCTTAGCGTCGATGGTAGTCGAACT TACGTTCCGCTAGAGTAGAACG

TTGCCAGCCAAAAAAATGAAATGGAAA (827nt)

Alignment of the above three sequences revealed

LNZr1

TGGACGCCCTCAGT-CCTCAG-AATGGTTGGAA TCATTCATAGA 42

LNZr5CCTAAAAAAAAAAGAGGAGCTAAG-TT CCTCAG-AATGGTTGGAAATCATTCATAGA 55

LNZcontrl

CGAGAGCGCTAAGGGTTTCCCTCAGGAAT GGTTGGAA-TCATTCATAGA 48

**********************************

LNZr1

GTGTAAAGGCAT AAGGGAGCTTGAC TGCGAGA CCTACAAGTCGAG CAGGGTC GAAAGACG 102

LNZr5

GTGTAAAGGCATAAGGGAGCTTGACTGCGAG ACCTACAAGTCGAGCAGGGTCGAAAGACG 115

LNZcontrl

GTGTAAAGGCATAAGGGAGCTTGACTGCGA GACCTACAAGTCGAGCAGGGTCGAAAGACG 108

*************************************** *********************

LNZr1

GACTTAGTGATCCGGTGGTTCCGCATGGAA GGGCCATCGCTCAACGGATAAAAGCTACCC162

LNZr5

GACTTAGTGATCCGGTGGTTCCGCATGGAAG GGCCATCGCTCAACGGATAAAAGCTACCC175

LNZcontrl

GACTTAGTGATCCGGTGGTTCCGCATGGAAG GGCCATCGCTCAACGGATAAAAGCTACCC 168

***************************************** *******************

LNZr1

CGGGGATAACA GGCTTATCT CCCCCA AGAGTT CACATCGACG GGGAGGTT TGGCACCTCG 222

LNZr5

CGGGGATAACAGGCTTAT CT CCCCCAAGAGTT CACATCGACGGGGAGGTTTGGCACCTCG 235

LNZcontrl

CGGGGATAACAGGCTTATCTCCCCCAAGAGT TCACATCGACGGGGAGGTTTGGCACCTCG 228

**************************************** ********************

LNZr1

ATGTCGGCTCATCGCATCCTGGGGCTGTAGT CGGTCCCAAGGGTTGGGCTGTTCGCCCAT 282

LNZr5

ATGTCGGCTCATCGCATCCTGGGGCTGTAGT CGGTCCCAAGGGTTGGGCTGTTCGCCCAT 295

LNZcontrl

ATGTCGGCTCATCGCATCCTGGGGCTGTAGT CGGTCCCAAG GGTTGGGCT GTTCGCCCAT 288

***************************************** *******************

LNZr1

TAAAGCGGTACGCTAGCTGGGTTCAGAACGTC GTGAGACAGTTCGGTCCCTATCCGTCGT 342

LNZr5

AAGCGGTACGCTAGCTGGGTTCAGAACGTCGT GAGACAGTTCGGT CCCTATCCGTCGT 355

LNZcontrl

TAAAGCGGTACGCGAGCTGGGTTCAGAACGT CGTGAGACAGTTCGGTCCCTATCCGTCGT 348

***************************************** ******************

LNZr1

GGGCGTAGGAAATTTGAGAGGAGCTGTCCT TAGTACGAGAGGACCGGGATGGACATACCT 402

LNZr5

GGGCGTAGGAAATTTGAGAGGAGCTGTCCT TAGTACGAGAGGACCGGGATGGACATACCT 415

LNZcontrl

GGGCGTAGGAAATTTGAGAGGAGCTGTCCTTA GTACGAGAGGACCGGGATGGACATACCT 408

*************************************** *********************

LNZr1

CTGGTGTACCAGTTGTCGTGCCAACGGCATA GCTGGGTAG CTATGTATGG ACGGGATAAG 462

LNZr5

CTGGTGTACCAGTTGTCGTGCCAACGGCATAG CTGGGTAGCTATGTATGGACGGGATAAG 475

LNZcontrl

CTGGTGTACCAGTTGTCGTGCCAACGGCAT AGCTGGGTAGCTATGTGTGGACGGGATAAG 468

********************************************** *************

LNZr1

TGCTGAAAGCATCTAAGCATGAAGCCCCCCTC AAGATGAGATTTCCCAACTTCGGTTATA 522

LNZr5

TGCTGAAAGCATCTAAGCATGAAGCCCCCCT CAAGATGAGATTTCCCAACTTCGGTTATA 535

LNZcontrl

TGCTGAAAGCATCTAAGCATGAAGCCCCCC TCAAGATGAGATTTCCCAACTTCGGTTATA 528

************************************** **********************

LNZr1

AGATCCCTCAAAGATGATGAGGTTAATAGGTT CGAGGTGGAAGCGTGGTGACACGTGGAG 582

LNZr5

AGATCCCTCAAAGATGATGAGGTTAATAGGTT CGAGGTGGAAGCGTGGTGACACGTGGAG 595

LNZcontrl

AGATCCCTCAAAGATGATGAGGTTAATAGGT TCGAGGTGG AAGCATGGT GACATGTGGAG 588

******************************************** **************

LNZr1

CTGACGAATACTAATCGATCGAAGACTTAAT CAATTTATTTCAATGTTTTGCGAAGCAAA 642

LNZr5

CTGACGAATACTAATCGATCGAAGACTTAAT CAATTTATTTCAATGTTTTGCG AAGCAAA 655

LNZcontrl

CTGACGAATACTAATCGATCGAAGACTTAAT CAAAATA-AATGTTTTGCGAAGCAAA 644

*************************************** ***************

LNZr1

ATCA-TTTACTTACTATCTAGTTTTGAATGTAT AAT-CATTCTCTT GTCTGGTGACA 697

LNZr5

ATCA-TTTACTTACTATCTAGTTTTGAATGT ATAAT CATTCTCTTGTCTGGTGACA 710

LNZcontrl

ATCACTTTTACTTACTATCTAGTTTTGAATG TATAATTTACATTCATATGTCTGGTGACT 704

**************************************** ***********

LNZr1

ATGGCAAGGAGGTCACACCTGTTCCCATGCC GAACACAGAAGTTAAGCTCCTTAGCGCCG 757

LNZr5

ATGGCAAGGAGGTCACACCTGTTCCCATGCCG AACACAGAAGTTAAGCTCCTTAGCGCCG 770

LNZcontrl

ATAGCAAGGAGGTCACACCTGTTCCCAT GCCGAACACAGAAGTTAAGCTCCTTAGCG TCG764

**********************************************************

LNZr1

ATGGTAGTTGGATTTACGTTCCGCTAGAGTAG GACGTT GCCAGCCAAA-AAAATA-811

LNZr5

ATGGTAGTTGGATTTACGTTCCGCTAGAGT AGGACGTTGCCAGGCAAATTAAATTATTCC 830

LNZcontrl

ATGGTAGTCGAACTTACGTTCCGCTAGAGTAG AACGTTGCCAGCCAAA-AAAAT- 817

***************************************

LNZr1

GAGATGGGAA 821

LNZr5

ACAGTAGTCTATTGTGGTTTAGGAAAGAAAA 861

LNZcontrl

GAAATGGAAA 827

*****

Sequencing of the domain V region of the 23S rRNA gene revealed the presence of a G2576U mutation (Escherichia coli numbering) in LRSA (LZD-resistant S. aureus) in comparison to LSSA (LZD-sensitive S. aureus) in two 23s rRNA copy, rrn1 and rrn5. Although we noticed other mutations, we could not find any other reported mutation like G2447U, G2505A, C2512U, G2513U, and C2610G.


   Discussion Top


Linezolid resistance, thankfully, is an extremely rare phenomenon. The Zyvox Annual Appraisal of Potency and Spectrum (ZAAPS) study, 2007 for linezolid resistance came up with an overall resistance rate to linezolid in 23 countries to 0.03%. [5] A similar worldwide program, LEADER 2009, which monitors and tracks linezolid resistance in USA since 2004, reported the resistance rate to be 0.34%. [7]

Data on linezolid resistance from Asian countries, especially Indian subcontinent is extremely rare and whatever scarce reports are found-DNA sequencing to point out the type of point mutation/mechanism of resistance has not been performed in almost all the cases. The strain of S. aureus found by us was unique in the sense that it was an MRSA strain showing resistance to linezolid, hence compromising almost all the avenues of treatment. It is high time that we wake up, take notice of impending doom, recognize the dangerous outcomes of a great threat, closely monitor the resistance pattern evolving, and track it down with the tools of molecular epidemiology.





The authors gratefully acknowledge Dr. Manas Maiti, Senior Scientist, Department of genetics, for PCR and DNA sequencing.

 
   References Top

1.Diekema DJ, Jones RN. Oxazolidinone antibiotics. Lancet 2001;358:1975-82.  Back to cited text no. 1
    
2.Swaney SM, Aoki H, Ganoza MC, Shinabarger DL. The oxazolidinone linezolid inhibits initiation of protein synthesis in bacteria. Antimicrob Agents Chemother 1998;42:3251-5.  Back to cited text no. 2
    
3.Pillai SK, Sakoulas G, Wennersten C, Eliopoulos GM, Moellering RC Jr, Ferraro MJ, et al. Linezolid resistance in Staphylococcus aureus: Characterization and stability of resistant phenotype. J Infect Dis 2002;186:1603-7.  Back to cited text no. 3
    
4.Jones RN, Fritsche TR, Sader HS, Ross JE. LEADER surveillance program results for 2006: An activity and spectrum analysis of linezolid using clinical isolates from the United States (50 medical centers). Diagn Microbiol Infect Dis 2007;59:309-17.  Back to cited text no. 4
    
5.Jones RN, Kohno S, Ono Y, Ross JE, Yanagihara K. ZAAPS International Surveillance Program (2007) for linezolid resistance: Results from 5591 Gram-positive clinical isolates in 23 countries. Diagn Microbiol Infect Dis 2009;64:191-201.  Back to cited text no. 5
    
6.Clinical and Laboratory Standards Institute. Performance standards for antimicrobial susceptibility testing; 16th informational supplement. M100-S16. Wayne, PA: CLSI; 2006.  Back to cited text no. 6
    
7.Farrell DJ, Mendes RE, Ross JE, Sader HS, Jones RN. LEADER Program Results for 2009: An activity and spectrum analysis of linezolid using 6,414 Clinical isolates from 56 medical centers in the United States. Antimicrob Agents Chemother 2011;55:3684-90.  Back to cited text no. 7
    

Top
Correspondence Address:
Dibyendu Banerjee
27-H, Rajkrishna Street, Uttarpara - 712 258, West Bengal
India
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/1755-6783.140243

Rights and Permissions


    Figures

  [Figure 1]



 

Top
 
  Search
 
    Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
    Email Alert *
    Add to My List *


    Abstract
   Introduction
    Materials and Me...
   Discussion
   Acknowledgment
    References
    Article Figures

 Article Access Statistics
    Viewed1258    
    Printed44    
    Emailed0    
    PDF Downloaded6    
    Comments [Add]    

Recommend this journal