Annals of Tropical Medicine and Public Health
Home About us Ahead Of Print Instructions Submission Subscribe Advertise Contact e-Alerts Editorial Board Login 
Users Online:2121
  Print this page  Email this page Small font sizeDefault font sizeIncrease font size
 


 
Table of Contents   
ORIGINAL ARTICLE  
Year : 2017  |  Volume : 10  |  Issue : 1  |  Page : 222-227
A study on the blood feeding behavior of sand flies on ABO blood groups using PCR methods in Southeastern Iran


1 Research Center for Hydatid Disease in Iran, Kerman University of Medical Sciences, Kerman, Iran
2 Leishmaniasis Research Center, Kerman University of Medical Sciences, Kerman, Iran
3 Department of Medical Virology, Kerman University of Medical Sciences, Kerman, Iran
4 Department of Medical Entomology and Vector Control, School of Public Health, Tehran University of Medical Sciences, Tehran, Iran

Click here for correspondence address and email

Date of Web Publication5-May-2017
 

   Abstract 

Objective: Cutaneous leishmaniasis (CL) is presently occurring in Kerman province, southeastern Iran. The objective of this study was to determine the correlation between the different blood groups and the blood feeding behavior of sand flies. Materials and Methods: Sticky paper traps were used to collect sand flies in the study location. Traps were set at dusk and flies were collected at dawn. A total of 200-300 sticky traps were set each day in each area. Results: A total of 1320 sandflies were collected; 320 blood-fed female sandflies were selected for the analysis of blood meals by PCR-RFLP. In this study, 82 (25.6%) sandflies fed on human blood meals. Conclusion: The results of the current study clearly indicated that there is a significant relationship between the different blood groups and the blood feeding behavior of sand flies.

Keywords: ABO groups, Kerman, Iran, Phlebotomus sergenti

How to cite this article:
Majid FH, Abbas AA, Mollaie H, Akbarzadeh K. A study on the blood feeding behavior of sand flies on ABO blood groups using PCR methods in Southeastern Iran. Ann Trop Med Public Health 2017;10:222-7

How to cite this URL:
Majid FH, Abbas AA, Mollaie H, Akbarzadeh K. A study on the blood feeding behavior of sand flies on ABO blood groups using PCR methods in Southeastern Iran. Ann Trop Med Public Health [serial online] 2017 [cited 2019 Sep 21];10:222-7. Available from: http://www.atmph.org/text.asp?2017/10/1/222/205590

   Introduction Top


Leishmaniasis remains a leading cause of morbidity and mortality in numerous countries throughout the world. Leishmaniasis is a complex disease caused by several species of the genus Leishmania. It is transmitted to human by the bite of female sand flies.[1] Cutaneous leishmaniasis (CL) is an important health problem in Iran, and both Zoonotic Cutaneous Leishmaniasis (ZCL) and Anthroponotic Cutaneous Leishmaniasis (ACL) forms of the disease are endemic in Iran. Two epidemiological forms of CL occur in Kerman province, southeastern Iran.[2],[3],[4],[5],[6] The disease has also emerged in new foci during recent decades.[7],[8],[9] The association of certain human blood groups with the parasite is poorly understood. In some cases, positive correlations have been demonstrated, as in schistomiasis[10] and Giardiasis,[11] while in other cases, such as filariasis,[12] no evidence of association have been illustrated by the investigators. Decker-Jacson and Honigberg realized that surface glycoproteins of Leishmania tropica and L. donovani were analogous to certain ABO blood groups, suggesting a possible escape mechanism for these glycoproteins to certain ABO blood groups of patients.[13],[14] On the contrary, a study on American visceral leishmaniasis (AVL) caused by L. donovani in Brazilian patients did not show any significant relationship between ABO blood groups and the development of the disease.[15],[16]

This study was conducted to determine whether there is an association between the different types of blood group and the blood feeding behavior of sand flies in Kerman province, southeastern Iran.


   Materials and Methods Top


Sample collection

Sticky traps were used in the collection of sandflies in the study location. Traps were set at dusk, and sandflies were collected at dawn. A total of 200-300 sticky traps were set each day in each area. Collection of sample began in early July 2013, and continued until late September 2014 when sand fly activity has reduced drastically. Trapped sand flies were removed from the stick papers by the use of needles, washed with absolute ethanol, and transferred into micro tubes filled with 96% ethanol solution. The tubes were kept frozen (-20°C) for species identification and DNA extraction. Totally, 1320 blood-fed sandflies were collected.

Analysis of blood meals fed by the sand flies

Of the 1320 blood-fed sand flies, 320 were females including species of Phlebotomus sergenti (182), Phlebotomus papatasi (110), Phlebotomus caucasicus (20) and Phlebotomus major (8), and were selected for blood meal identification by PCR-RFLP.

Extraction of DNA from blood meals in sand flies

DNA extraction was performed in blood-fed females. Male sandflies, non-fed female sandflies and sterile water were used as negative controls, while, human and cow were considered as positive controls. The samples were individually disrupted by mechanical homogenization in a buffer solution containing 10 mM Tris-HCl, 312.5 mM EDTA, 1% (w/v) sodium lauryl sarcosine, and 1% polyvinyl pyrolidone at a pH of 8.0. Homogenates were heated at 90°C for 20 min, and eventually immersed in ice for 5 min. The samples were subsequently centrifuged at 13,000 RPM for 5 min at room temperature. The supernatants were discarded, and the resulting solution diluted in 10 mM Tris-HCl, pH 8.0, 1 mM EDTA. Finally, 82 samples were selected for ABO grouping and blood meal determination.

PCR amplification of the mtDNAcyt b gene

Two regions of the mtDNAcyt b gene were amplified for blood meal identification of the blood-fed female specimens. In the verification of human blood meals, a portion (358 bp) of the cyt b gene was amplified and digested with Xho I enzyme. The sequence of the primers used was as follows: 5'-CCATCCAACATCTCAGCATGATGAAA-3' (forward) and 5'-CCCCTCAG AATGATATTTGTCCTCA-3' (reverse) primers. The PCR amplifications were completed in a 25 μL solution containing 10 mM Tris-HCl, pH 8.3, 50 mM KCl, 1.5 mM MgCl2, 0.001% gelatin, 200 mM deoxynucleotide triphosphates, 10 pmol of each primer,1 unit of Taq DNA polymerase (Takara, Japan), and 2.5 μl of DNA template solution. The samples were then incubated at 95°C for 3.5 min, followed by 36 cycles at 95°C for 30s, 58°C for 50 s, 72°C for 40 s; and at 72°C for 5 min. To distinguish and identify blood meals of animal host, a second region of the mtDNA cytB gene was amplified by forward and reverse primers (5'-TGAGGACAAATATCATTCTGAGG-3' (UNFOR403) and 5'-GGTTGTCCTCCAATTCATGTTA-3'(UNREV1025), respectively. The primers were used to amplify a 623-base pair region of the cytB gene of vertebrate mt DNA. The PCR amplifications were performed in 25 μL of a solution containing 10 mM Tris, pH 8.3,50 mM KCl, 1.5 mM MgCl 2, 0.01% gelatin, 1.0m Mdeoxynucleotide triphosphates, 0.5 units of Taq polymerase, 50 pmol of each primer, and 2.5 μL of extracted DNA. The samples were later incubated at 95°C for 5 min, followed by 35 cycles at; 95°C for 1 min, 58°C for 1 min, 72°C for 1 min and 72°C for 7 min. The resulting products were visualized following agarose gel electrophoresis (2% agarose stained with ethidium bromide). Electrophoresis was conducted using a Gene Ruler 100-basepair molecular marker (Takara, Japan).

Sequence analysis for the selection of restriction enzymes

Available sequences of the 623 bp for human and probable vertebrate hosts (cow, goat, horse, ass, dog, and other Canidae) in the study area were obtained from the Gene Bank. These data were investigated to check for species-specific restriction enzyme sites of each host DNA using the Neb cutter program (http://tools.neb.com/nebcutter). 28 sequence analyses showed there were no restriction sites for Hae III on the human PCR products, however, there were numerous restriction sites in the PCR products for other vertebrates. This enzyme was selected for the differentiation of blood meal sources within the blood-fed sandflies. The digestion of PCR products was done in a 25 μL solution containing 15 μL of PCR product mixed with 2.5 μL of the enzyme buffers, and 5 units of the restriction enzyme overlaid with two drops of mineral oil (Fermentase, Germany). The mixture was incubated at the temperature recommended by the suppliers of the enzymes. An aliquot (14 μL) of the digestion products was mixed with 6 mL of loading buffer (0.25% bromophenol blue, 0.25% xylene cyanol, 30% glycerol), loaded onto a 2.5% agarose gel, and eventually subjected to electrophoresis. Gels were stained with ethidium bromide (2 mg/mL) and the RFLP profiles were visualized under ultraviolet light.


   Allele Frequencies Top


82 sandflies were selected for the estimation of allele frequencies of the ABO blood groups.

Amplification of DNA Fragments for ABO grouping

The standard PCR method of DNA amplification for the ABO gene locus was used with a few modifications to enhance optimization. Two DNA fragments of the ABO locus were designed to be amplified by two pairs of primers as described in [Figure 1] (synthesized by MWG, Germany). Primers (ABO-1 and ABO-2) were used for amplification of the 200-bp fragment including the 258th nucleotide. Other primers (ABO-3 and ABO-4) were used for amplification of the 128-bp fragment including the 700th nucleotide. Amplification was accomplished in 100 uL reaction mixture containing 50 ng of extracted DNA, 10 uL of PCR reaction buffer, 200 uM of each dNTP, 2 units of Taq DNA polymerase (Takara, Japan), and 15 pmol of each primer. A total of 35 cycles of amplification were finalized, but the conditions varied for each set of primers. For ABO-1 and ABO-2 primers, the following procedures were ensured; denaturation was carried out for 2 minutes at 94°C, followed by annealing of the primers for 2 minutes at 55°C, and subsequent extension for 3 minutes at 72°C. For ABO-3 and ABO-4 primers, denaturation was performed for 2 minutes at 94°C, followed by annealing of the primers for 2 minutes at 58°C, and subsequent extension for 3 minutes at 72°C. The amplified products were verified by electrophoresis on a 2% agarose gel (Pharmacia, Uppsala, Sweden), and directly visualized under UV light after staining with ethidium bromide.
Figure 1: Electrophoresis of mitochondrial DNA cytochrome B gene fragments from blood meals of sand flies digested with Hae III. Partial fragments (623 bp) of the cytochrome B gene from vertebrate hosts (human, cow, dog) of sand flies were amplified by a polymerase chain reaction and the products were digested with Hae III. Lane 1, mixture of human and dog blood; Lane 2, cow blood; Lane 3, mixture of cow and dog blood; Lane 4, human blood; Lane 5, dog blood; Lane 6, mixture of human and cow blood; lane M, molecular weight marker (100 bp )

Click here to view



   RFLP Analysis Top


The amplified products of the first and second primers were digested with KpnI, and products of the third and fourth primers were digested with AluI. Ten microliters of each PCR-amplified product were digested with 5 units of either KpnI or AluI restriction enzyme (Biolabs, UK) for 1 hour. The digested and amplified DNA was then run on a 3% agarose gel in TBE buffer. The gel was stained for 15 minutes in 0.5 ug/mL ethidium bromide, and the bands were visualized in UV light. A 100-bp ladder (Takara, Japan) was used as a marker for the estimation of fragment sizes.


   Real Time PCR Top


In the determination of the ABO groups and their phenotypes, a Real Time PCR technique in a base of Cyber green dye was employed. The extracted DNA were subjected to PCR in a total volume of 25 μl using three set of forward and reverse primers; the first pair was AGCTCCATGTGACCGCACGC (forward primer) and AATGGGAGCCAGCCAAGGGGTA (reverse primer), the second pair was CCAAGGACGAGGGCGATTTCTACTA-CC (forward primer) and GGTGGTTCTTGGGCACCGCA (reverse primer), the third pair was AGCTGTCA-GTGCTGGAGGTGG (forward primer), and TGTAGGCCT-GGGACTGGGGC (reverse primer). The primers were designed depending on deletion and substitution mutations in exon 7. The PCR reaction consisted of 1 μl of each primer, forward and reverse, and 2 μl of the DNA template. Consequently, 12.5 μl of 2 X Green master mixes (Fermentase, Germany) was added, and the total volume was completed by the addition of 8.5 μl of ultra-pure water. PCR incubation was achieved using a Real Time PCR system (Rotorgene 6000, Corbett). The conditions of the cycles were as follow: initial denaturation of the DNA was allowed for 5 min at 95°C, followed by 35 cycles (of denaturation at 94°C for 30 sec, annealing at 60°C for 30 sec and extension at 72°C for 30 sec). Data was collected in a green channel (provided by a melting temperature from 55°C to 95°C) following the PCR cycles .


   Results Top


Blood meal analysis in sand flies

A total of 1320 sandflies were collected, in which 320 blood-fed female sandflies were selected for the analysis of blood meal by PCR-RFLP. In this study, 82 (25.6%) sandflies fed on human.


   Phenotypes and Gene Frequencies Top


No previous data are available concerning the distribution of phenotypes and gene frequencies of the ABO blood group system among the sandflies.


   Molecular Genotyping in RFLP-PCR Top


According to Yamamoto et al., there are 4 consistent nucleotide substitutions of transferase A leading to changes in the amino acids (residues 176, 235, 266, and 268) to form transferase B, B allelic cDNA. The formation of an O allelic cDNA is due to the deletion of a nucleotide in the 258th position, which causes the loss of transferase activity. In the present study, we applied the PCR-RFLP method for the analysis of nucleotides in the 258th and 700th positions of cDNA in transferase A to determine the ABO genotyping. Two regions of the ABO glycosyl transferase gene were amplified, each containing a diagnostic restriction enzyme site [Figure 2].
Figure 2: Restriction fragments obtained from the digestion of the ABO-3 and ABO-4 PCR products with AluI. Ladder 50 bp

Click here to view


Primers 1 and 2 amplified a 199 or 200bp DNA fragment containing the 258th nucleotide of cDNA in the ABO locus. If the 258th nucleotide does not exist, the PCR product would produce a 199 bp O allele-specific fragment, which will create a KpnI cleavable site on the O allele-specific sequence. However, if the 258th nucleotide exists, the fragment produced would be a 200 bp fragment, and there would be no KpnI cleavable site. Therefore, when this fragment was completely digested by KpnI, a 171-bp and 28-bp fragments were found and recognized as homozygote OO, and the 171-bp fragment was used as an O allele marker. When the fragment was half digested, 200, 171, and 28-bp fragments were found and recognized as heterozygote gene or BO. When no digestion occurred, no O allele was confirmed and genotypes AA, AB, and BB were possible candidates [Table 1].
Table 1: ABO Genotype Interpretation by Restriction Enzyme Digestion of PCR Products

Click here to view


Primers 3 and 4 amplified a 128 bp fragment containing the 700th nucleotide of cDNA in the ABO locus. If the 700th nucleotide contains allele A, this fragment would be B allele specific, and there would be an AluI cleavable site on the B allele-specific sequence. Therefore, when this fragment was completely digested by AluI, 88- and 40-bp fragments were found and recognized as homozygote BB, as shown in [Table 2], and the 88-bp fragment was used as a B allele marker. When the fragment was half digested, 128-, 88-, and 40-bp fragments were found to be heterozygote genotype AB or BO. When there was no digestion by AluI, no B allele was confirmed, and genotypes AA, AO, and OO were possible. When neither 200- nor 128-bp fragments could be digested, homozygote AA allele was determined. By examining the digested patterns of these 2 fragments, ABO genotypes were easily determined, as shown in [Table 2].
Table 2: Pattern of Restriction Fragments Visualized After Digestion of the PCR Product

Click here to view


Allele Frequencies of ABO blood grouping

According to the present study, a total of 82 female sand flies blood-fed on human, and the analysis with PCR-RFLP and Real Time PCR methods revealed that the results in both methods were similar [Figure 3] and [Figure 4]. 32 samples (39.02%) belonged to the blood group O, 21 samples (25/60%) were included in the AB blood group, 8 samples (9.75%) belonged to blood group A, and 6 samples (7.31%) were grouped under blood type B. 15 (18.29%) were undetectable such that the probability that the DNA was destroyed during the loading process was very low.
Figure 3: Melting curve of Real Time PCR in ABO grouping

Click here to view
Figure 4: Restriction fragment patterns of the digested polymerase chain reaction (PCR) products obtained with the restriction enzymes as visualized on a 3% agarose gel stained with ethidium bromide. The different lanes represent the different samples analyzed and their ABO genotypes., Restriction fragments obtained from the digestion of the ABO-1 and ABO-2 PCR products with KpnI

Click here to view



   Discussion Top


Prior to the completion of this study, no previous data have been available regarding the distribution of phenotypes and the gene frequencies of the ABO blood group system among sand flies. In the present study, the PCR-RFLP method was utilized for the analysis of nucleotide positions 258 and 700 of cDNA in a transferase to determine the ABO genotyping. The findings thus fail to support the hypothesis, based on the serotyping of leishmania excreted factors and studies of leishmania surface glycoprotein's, that there is a relationship between ABO blood group and leishmaniasis in humans.[17],[18] In the present study, a simple and reliable ABO genotyping system using allele-specific primers and real-time PCR was developed. Although melting curve analysis is indispensable for confirming the specificity of each reaction system, its rapidity, together with its simplicity and accuracy, should promote the acceptance of the real-time PCR detection format, which eliminates tedious post-PCR manipulations such as gel electrophoresis. Thus, this system has great potential for automation in ABO genotyping. The sensitivity of detection in this method was nearly 2.0 ng of DNA, because each reaction system requires 0.5 ng of DNA for accurate ABO genotyping. In addition, the size of the PCR amplicons (not longer than 107 bp) was sufficiently small to allow partially degraded DNA to be used for genotyping. Our results disclosed that the blood feeding behavior of sand flies is diverse in the different blood groups of human. The results of the current study clearly indicated that there is a significant relationship between the different blood groups and the blood feeding behavior of sand flies. In conclusion, we have established a real-time PCR method using allele-specific primers for rapid and accurate ABO genotyping. This method could serve as a useful complement to the classic serological ABO typing and would be useful in forensic applications.

Acknowledgement

The authors wish to acknowledge the financial support of Kerman University of medical Sciences (Grant No.1284) and the technical support and partial contribution of Leishmaniasis Research Center of Kerman University of Medical Sciences for this study.

Financial support and sponsorship

Nil

Conflict of interests

There are no conflicts of interest.

 
   References Top

1.
Rassi Y, Oshaghi MA, Mohammadi Azani S, Abaie MR, Rafizadeh S, Mohebai M. Molecular detection of Leishmania infection due to Leishmania major and Leishmania turanica in the vectors and reservoir host in Iran. Vector-borne Zoonotic Dis 2011;11:145-50.  Back to cited text no. 1
    
2.
Khosravi A, Sharifi I, Dortaj E. The present status of cutaneous leishmaniasis in a recently emerged focus in South-west of Kerman Province, Iran. Iran J Public Health 2013;42:182-7.  Back to cited text no. 2
    
3.
AghaeiAfshar A, Vatandoost H, Sharifi I. First determination of impact and out-come indicators following indoor residual spraying (IRS) with deltamethrin in a new focus of anthroponotic cutaneous leishmaniasis (ACL) in Iran. Asian Pac J Trop Dis 2013;3:5-9.  Back to cited text no. 3
    
4.
Mozafary M, Dayer MS, AghaeiAfshar A, Mollaie HR. Molecular characterization of Leishmania parasites in naturally infected sand flies from the endemic focus of Kerman City, Southeastern Iran. Asian Pac J Trop Dis 2016;6:188-92.  Back to cited text no. 4
    
5.
Aghaei Afshar A, Rassi Y, Sharifi I, Vatandoost H, Mollaie H, Oshaghi MA, et al. First report on natural Leishmania infection of Phlebotomus sergenti due to Leishmania tropica by high resolution melting curve method in South-eastern Iran. Asian Pac J Trop Med 2014;7:93-6.  Back to cited text no. 5
    
6.
Aflatoonian MR, Sharifi I. The epidemiol-ogy of cutaneous leishmaniasis in the city and suburb of Bam in 2010: active case-finding, treatment and health education of the school children. Iran J Epidemiol 2011;7:52-57.  Back to cited text no. 6
    
7.
Sharifi F, Sharifi I, Zarean M. Spatial distribution and molecular identification of Leishmania species from endemic foci of south-eastern Iran. Iran J Parasitol 2011;7:45-52.  Back to cited text no. 7
    
8.
Sharifi I, Poursmaelian S, Aflatoonian MR. Emergence of a new focus of anthroponotic cutaneous leishmaniasis due to Leishmania tropica in rural communities of Bam dis-trict after the earthquake, Iran. Trop Med Int Health 2011;16:510-13.  Back to cited text no. 8
    
9.
Afshar A, Rassi Y, Sharifi I, Abai M, Oshaghi M, Yaghoobi-Ershadi M, et al. Susceptibility status of Phlebotomus papatasi and P. sergenti (Diptera: Psychodidae) to DDT and deltamethrin in a focus of cutaneous leishmaniasis after earthquake Strike in Bam, Iran. Iran J Arthropod Borne Dis 2011;5:32-41.  Back to cited text no. 9
    
10.
Pereira FE, Bortolini ER, Carneiro JL, Da Silva CR, Neves RC. ABO blood groups and hepatosplenic form of Schistosomia mansoni (Symmer's fibrosis). Trans R Soc Trop Med Hyg 1979;73:238.  Back to cited text no. 10
[PUBMED]    
11.
Barnes GL, Kay R. Blood groups in giardiasis. Lancet 1997;1:808-12.  Back to cited text no. 11
    
12.
Higgins DA, Jenkins DJ, Partono F. Timorianfilariasis and ABO blood groups. Trans R Soc Trop Med Hyg 1985;79:537-8.  Back to cited text no. 12
    
13.
Decker-Jackson JE, Honigberg BM. Glycoproteins released by Leishmania donovani. Immunological relationships with host and bacterial antigens and preliminary biochemical analysis. J of Parasitol 1978;25:514-25.  Back to cited text no. 13
    
14.
Greenblatt CL, Kark JD, Schnur LF, Slutzky GM. Do leishmania serotypes mimic human blood group antigens. Lancet 1981;1:505-6.  Back to cited text no. 14
    
15.
Evans T, Talapala GN, Pearson RD. The relationship of American visceral leishmaniasis to ABO blood group type. Am J Trop Med Hy 1984;33:805-7.  Back to cited text no. 15
    
16.
Yip, S.P. Sequence variation at the human ABO locus. Ann Hum Genet 2002;66:1-27.  Back to cited text no. 16
    
17.
Ferri G, Bini C, Ceccardi S, Ingravallo F, Lugaresi F, Pelotti S, et al. Mini sequencing based genotyping of Duffy and ABO blood groups for forensic purposes. J Forensic Sci 2006;51:357-60.  Back to cited text no. 17
    
18.
Li R, Huian Z, Qinnge L. Multicolor real-time PCR genotyping of ABO system using displacing probes. J Forensic Sci 2010;55:19-24.  Back to cited text no. 18
    

Top
Correspondence Address:
Dr. Aghaei Afshar Abbas
Leishmaniasis Research Center, Kerman University of Medical Sciences, Kerman
Iran
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/1755-6783.205590

Rights and Permissions


    Figures

  [Figure 1], [Figure 2], [Figure 3], [Figure 4]
 
 
    Tables

  [Table 1], [Table 2]



 

Top
 
  Search
 
    Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
    Email Alert *
    Add to My List *


    Abstract
   Introduction
    Materials and Me...
   Allele Frequencies
   RFLP Analysis
   Real Time PCR
   Results
    Phenotypes and G...
    Molecular Genoty...
   Discussion
    References
    Article Figures
    Article Tables

 Article Access Statistics
    Viewed1037    
    Printed27    
    Emailed0    
    PDF Downloaded19    
    Comments [Add]    

Recommend this journal